Clicky

[Investigation of human herpesvirus-8 seroprevalence in blood donors and HIV-positive patients admitted to Ege University

(A) Coprecipitation assays analogous to those described in the legend of Fig. The mDRM fractions and total cell extracts derived from 293T cells transfected with Flag-tagged full-length vIRF-1 (FL) or 18 deletion mutants were immunoblotted (IB) with the indicated antibodies. In contrast, type 1 anti-inflammatory cytokines such as interferon (IFN) and TGF-β trigger down regulation of DC-SIGN expression of MDDC (Relloso et al., 2002). Archer S, Rich S. The latter coprecipitated with chitin bead-bound vIL-6–CBD, but not by chitin beads supplemented with hIL-6-CBD (Fig. There were no apparent hybridization signals observed in either of these two control experiments ( Fig. Mutation of the other putative NLS sequences did not significantly affect vIRF-1 localization (data not shown).

We report here for the first time that many KS patients have high levels of anti-v-cyclin antibodies. It may be important that the antigens used for an anti-HHV8 antibody assay contain both latent and lytic proteins, because some of the sera in this study reacted only with either latent or lytic proteins. (A) At top, detection of T1.1 RNA by Northern blot hybridization of 15 μg total RNA from adult MVDECs (bMVDECs), HUVECs, and 293 cells infected at the same time and under identical conditions. To investigate a possible discrepancy in the 5′ end of PAN RNA, primer extension of PAN RNA was performed. Study participants were part of a cohort study of 200 HIV-1-seronegative pregnant women. Expression of Tat in normal cells increases tumorigenesis by GR3 cells. Other cells expressed lower levels of ORF74, while many cells tested negative.

104). At 4 hours after infection whole-cell extracts were subjected to competition EMSA by using the oligonucleotide containing the consensus NF-κB element as a probe in the absence (−) or the presence (25X) of 25-fold excess unlabeled consensus oligonucleotide. This result is in contrast to a pediatric KS cohort from Mozambique that found no cases [76]. Coding sequences for the various vIL-6 proteins were cloned into a chitin-binding domain (CBD)-encoding expression vector to allow their expression in transfected cells as CBD fusion proteins and subsequent precipitation (from culture media) with chitin beads (3, 4). Cells were lysed in RIPA lysis buffer containing protease inhibitor cocktail. It is tempting to speculate that HHV-8 has a role in the development of the gastric lymphoma; however, the detection of HHV-8 sequences in the lymphoma tissue could reflect viremic spread via circulating lymphocytes. Two days postransduction, cells were lysed for Western blot analysis to detect phospho-STAT3 (pSTAT3) and pERK as indicators of gp130-activated STAT and MAPK pathways.

Rettig, J. Interestingly, in a separate study, we demonstrated that Rta also strongly activates the HHV-8/KSHV vIL-6 gene.23Like hIL-6, vIL-6 promotes the growth of IL-6–dependent B cells and activates signal transduction pathways. This modification was done by PCR using Pfu polymerase (Stratagene) with primers 5′-CTTAAGCTTGCCGCCATGGATTACAAGGATGACGACGATAAGGGATCCATGCCTCGC TACACGGAGTCGG and 3′-GGGAATTCTACATCAACCATCCTACCTCTGG. Photomicrographs showing extranodal nasal-type NK/T cell lymphoma in the splenic red pulp. It was purified with the Qiagen plasmid Maxi kit (Qiagen) and was sequenced by the dideoxynucleotide chain termination method according to the manufacturer’s recommendations (ABI Prism dRhodamine terminator cycle sequencing ready mix; Applied Biosystems). Semiquantitative analysis of gel electrophoresis and subsequent Southern blots showed higher levels of HHV-8 DNA in those patients with multicentric and visceral involvement than in those with localized disease (Table 2). Inflammatory cytokines, adhesion molecules, and endothelial cell activation are all centrally involved in this process (20), and the expression of many of these factors depends upon activation of the transcriptional regulatory factor NF-κB.

We also studied the specificity of the lytic PEL-based IFA. A total of 4954 men were enrolled between April 1984 and March 1985 at 4 study sites located in Baltimore, Chicago, Los Angeles, and Pittsburgh. A titration of DNA extracted from the primary effusion lymphoma cell line, HBL6, was included in each assay as a positive control. Another group succeeded in transmitting HHV-8 to human neonatal brain endothelial cells using a highly concentrated suspension of HHV-8 particles derived from the culture supernatant of BCBL-1 cells (23). The first 23 amino acids are most likely a cleavable signal sequence. Only 20 of the 65 HIV-positive, non-KS patients were homosexual. E-mail: reitz{at}umbi.umd.edu.

HHV-8 seroprevalence also was elevated, albeit not significantly, among men in Pittsburgh who had advanced prostate cancer than in men with other types of cancer and unknown PSA and DRE status [6]. Recently, the ORF26 gene of the HHV-8 genome was found to have single nucleotide polymorphisms (SNPs) that are linked to ORF K1 polymorphisms (16). Amalia Magaret, VIDD associate member Dr. Rhadinoviruses that infect New World monkeys include Herpesvirus saimiri, whose natural host is the squirrel monkey, and Herpesvirus ateles, which infects spider monkeys. However, due to space constraints, DNA extraction was performed on a bench in the main laboratory with template added to the PCR reaction mixture in a Top-safe 1.2 biological safety cabinet class II (BSCII) (Bio-Cabinets Australia Pty, Australia).